Archives

  • 2018-07
  • 2019-08
  • 2019-09
  • 2019-10
  • 2019-11
  • 2019-12
  • 2020-01
  • 2020-02
  • 2020-03
  • 2020-04
  • 2020-05
  • 2020-06
  • 2020-07
  • 2020-08
  • 2020-09
  • 2020-10
  • 2020-11
  • 2020-12
  • 2021-01
  • 2021-02
  • 2021-03
  • 2021-04
  • 2021-05
  • 2021-06
  • 2021-07
  • 2021-08
  • 2021-09
  • 2021-10
  • 2021-11
  • 2021-12
  • 2022-01
  • 2022-02
  • 2022-03
  • 2022-04
  • 2022-05
  • 2022-06
  • 2022-07
  • 2022-08
  • 2022-09
  • 2022-10
  • 2022-11
  • 2022-12
  • 2023-01
  • 2023-02
  • 2023-03
  • 2023-04
  • 2023-05
  • 2023-06
  • 2023-08
  • 2023-09
  • 2023-10
  • 2023-11
  • 2023-12
  • 2024-01
  • 2024-02
  • 2024-03
  • 2024-04

    • br Conclusions In this study we discovered

    2021-10-25


    Conclusions In this study, we discovered that the G-quadruplex (Q1) formed by S1 sequence in the upstream region of the transcription start site of c-Myb gene functioned as a positive transcriptional regulator, which was different from the most cases that G-rich sequences functioned to impair the initiation of transcription by RNA polymerase. The enhancer effect of the G-quadruplex formed by the S1 may due to the removal of a repressive transcription factor, in this case, MZF-1, as the S1 sequence contained the Amsacrine australia of MZF-1. Specifically, we found that topotecan, a water-soluble analog of camptothecin, had a high binding affinity with the c-Myb wild type G-quadruplex. In dual-luciferase reporter assays, topotecan up-regulated the transcriptional activities of the S1-wt plasmid, and comparing with the S1-mut plasmid, the relative activity of S1-wt plasmid was 2.3-folds of the control level when the concentration of topotecan was 10μM. Moreover, the intracellular transcriptional and translational of c-Myb were both enhanced. These evidence together strongly implied that topotecan could target the Q1 structure formed in c-Myb proximal promoter region during transcription and underlined the enhancer effect of Q1 G-quadruplex in c-Myb. In general, we have demonstrated that Q1 structure acted as activator modulating transcription in c-Myb gene and its function could be regulated by topotecan in cells, thereby discovering a novel regulatory element and its transcription regulation through the G-quadruplex structure in c-Myb gene.
    Introduction Nucleic acid-based aptamers are single-stranded DNA or RNA molecules that, adopting peculiar secondary structures, such as hairpins or internal stem-loops, bulges and G-quadruplexes, can recognize specific molecular targets with high affinity and selectivity [[1], [2], [3], [4], [5]]. They are usually selected by an iterative methodology called Systematic Evolution of Ligands by Exponential enrichment (SELEX) [1], introduced in the early 90s independently by the research groups of Gold and Szostak [[6], [7], [8]]. Using SELEX, several oligonucleotide aptamers were identified against different targets, emerging as promising candidate drugs and diagnostic tools. Among them, pegaptanib sodium, the active component of Macugen, was the first aptamer approved by FDA in 2004 for the treatment of age-related macular degeneration [[9], [10], [11]]. Since the introduction of SELEX, significant advances have been made to improve the selection procedures of aptamers against complex targets [12,13], and suitable modifications of this method have been introduced to generate a large number of effective aptamers. For instance, cell-SELEX technology was introduced using whole cells for the screenings, thus allowing the direct generation of aptamers against cell-surface targets in their native conformation [2,14,15]. Recently, a variant of cell-SELEX, known as Ligand Guided Selection (LIGS), has been designed to identify highly specific aptamers against cell-membrane receptors in their native functional state using a secondary ligand able to outcompete and selectively elute specific aptamers from an evolved cell-SELEX library [12,16]. By exploiting LIGS, a new aptamer was recently identified against membrane-bound immunoglobulins M (mIgM) expressed on B cells. Although this aptamer, termed R1, proved to recognize mIgM on target cells and efficiently compete with anti-IgM antibodies [16], its affinity was found to be too low for potential applications as a diagnostic tool for mIgM-expressing cells detection. R1 was thus truncated and, by systematic application of structure-activity relationship (SAR) studies, shorter variants were designed [17]. These efforts produced two truncated aptamers: i) a 42-mer, named R1.2, of sequence d(CACTGGGTGGGGTTAGCGGGCGATTTAGGGATCTTGAGTGGT), and ii) a 35-mer, indicated as R1.3, of sequence d(CACTGGGTGGGGTTAGCGGGCGATTTAGGGATCTT), obtained as a further truncation of R1.2. Both R1.2 and R1.3 were able to bind mIgM and showed improved affinity without any detectable loss in binding specificity [17]. Furthermore, binding assays showed that R1.2 was able to recognize the soluble form of immunoglobulin M (sIgM) as well. The concentration of sIgM is 45–150 mg/dL in normal human serum [18,19], while overexpression of sIgM is observed during the early stages of infection [20]. On the other hand, mIgM is overexpressed only in B-cell leukemia and lymphoma [[21], [22], [23]]. Therefore, R1.2- and R1.3-based biosensors could be valid, effective tools for the rapid and sensitive detection of both sIgM and mIgM. Taking into account that the precise measurement of the amounts of specific immunoglobulins in serum may be dramatically helpful for the early diagnosis of several diseases, primarily cancer, a detailed analysis of the biophysical properties of R1.2 and R1.3 aptamers and their interaction with the target proteins – necessary prerequisite for the design of suitable aptamer-based biosensors – is highly demanded.