Archives

  • 2018-07
  • 2019-08
  • 2019-09
  • 2019-10
  • 2019-11
  • 2019-12
  • 2020-01
  • 2020-02
  • 2020-03
  • 2020-04
  • 2020-05
  • 2020-06
  • 2020-07
  • 2020-08
  • 2020-09
  • 2020-10
  • 2020-11
  • 2020-12
  • 2021-01
  • 2021-02
  • 2021-03
  • 2021-04
  • 2021-05
  • 2021-06
  • 2021-07
  • 2021-08
  • 2021-09
  • 2021-10
  • 2021-11
  • 2021-12
  • 2022-01
  • 2022-02
  • 2022-03
  • 2022-04
  • 2022-05
  • br Conclusion br Conflict of

    2022-01-13


    Conclusion
    Conflict of interest Please refer to the accompanying ICMJE disclosure forms for further details.
    Exotic species such as hedgehogs are becoming popular companion animals. Therefore, they are more commonly seen in veterinary clinics. Acariasis is fairly common in these animals, usually those belonging to the Sarcoptidae ( and ) and Psoroptidae (, and ) families or even infestations of local species such as and spp. In most mammals, behaves as an opportunistic pathogen, and has the potential to change from a feeder to a parasite if the cutaneous environment is beneficial to the parasite's proliferation. The most common species is , causing the dermatological disease known as demodicosis, which generally affects young dogs as well as older animals. The diagnosis can be confirmed by the presence of mites in deep skin samples. Sequencing of the genome has proved to be a very effective taxonomic tool in phylogenetic studies and it has been used to classify mites. The mitochondrial 16S rDNA gene is the main sequence. Traditionally, the common treatments for mites such as in hedgehogs have included ivermectin injections and amitraz in spray form. Other treatments have included imidacloprid at 10% + moxidectin at 1% in hedgehogs for mites and the application of selamectin topically (spot on) for fleas at 30 mg and mites () at 45 mg. There was a noticeable improvement, with the absence of mites reported after 7 days; additionally, the animal experienced a complete recovery after 1 month., There have been developments in ectoparasiticides of the isoxazoline class with systemic oral administration. In recent reports, fluralaner has been used in hedgehogs to treat capariniasis with an acaricide effect at 14 days after administration and up to 120 days afterwards. Afoxolaner, an isoxazoline, was administered monthly to protect dogs from ticks and fleas, and has shown excellent results against mites such as and . This molecule has a high specificity due to a unique union site in the chlorine Polyphyllin VII mg regulated by the mite's GABA, which has no known relevant connection to the GABA receptor in mammals. In addition, it also has a wide safety margin. Its effectiveness against mites, the efficacy of the combination of afoxolaner with milbemycin oxime in a chewable form against common endoparasites has also been demonstrated in another study. Based on this evidence, the current study reports the case of a hedgehog with treated successfully with afoxolaner/milbemycin oxime. CASE REPORT The patient, a 4-year-old male African hedgehog weighing 600 g, presented with generalized erythema and periauricular scaling. The scaling was also present in the thoracic and pelvic areas as well as the central portion of the abdomen. It was also evident that the quills were easily removed and that papules affected the periauricular, ventral abdomen, and feet. The owners had this hedgehog from the age of 2 months. The hedgehog was in constant contact only with a dog and its environment, as it inhabited the same house as the owner. The presence of mites was identified in the patient, which had been treated 15 days before presentation with a subcutaneous single dose of ivermectin (Iverfull) at 300 µg/kg for skin lesions, with no success. Skin scrapings were taken and mites were found which morphologically corresponded to Demodex spp. Mites were found in all of the scraping areas. The samples were taken from five distinct areas: between the forelimbs, the hind limbs, the cervical region, ventral region of the abdomen, and the face (subsequent controls were taken from the same areas); samples were processed for the molecular identification of Demodex mites to the species level. The DNA was obtained from the skin scraping using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI USA), following the manufacturer's instructions. The absorbance of the DNA samples was measured with a Nano Droop 2000c (Thermo Scientific, WILM USA) to assess the quantity and quality. Molecular identification of the Demodex samples was achieved through the identification of a 340 base pair fragment of the 16S gene from the mitochondrial DNA, which was amplified using the following primers: Dem Forward 5'GAGGTATTTTGACTGCTAAGG 3' and Dem Reverse 5'TCAAAAGCCAACATCGAGG 3'. (Dem = Demodex). The conditions applied for the amplification were: 95°C for 10 min, 30 cycles of 94°C for 40 s, 55°C for 40 s, and 72°C for 45 s, and then a final extension stage at 72°C for 5 min. The products obtained from the amplification were visualized on a 3% agarose gel. Gel-purified PCR fragments were directly sequenced in an ABI Prism 3100 Genetic Analyser (Applied Biosystems, Foster City, CA USA). All of the obtained sequences were compared by multiple alignments to develop molecular and phylogenetic analysis using the MEGA 6 software (PSU, USA).